| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.012678 |
| Chromosome: | chromosome 4 |
| Location: | 3414422 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g800490 | (1 of 6) IPR002557 - Chitin binding domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCGTCGTGTGCTTGACCCAGCCGCGGTATGGTTCAGAACATACGCATT |
| Internal bar code: | GATACTACTCGATTTGTGCTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2407 |
| LEAP-Seq percent confirming: | 98.0392 |
| LEAP-Seq n confirming: | 50 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCGATATGGCTGTGGGTTT |
| Suggested primer 2: | CGTTATCAACCCAGCCACCT |