| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.012687 |
| Chromosome: | chromosome 2 |
| Location: | 176174 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g074350 | intron | ||
| Cre02.g074370 | CDPK8 | Calcium/calmodulin-dependent protein kinase; (1 of 18) K13412 - calcium-dependent protein kinase (CPK) | 3'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACTGATTCCATCACTCCGTTCTCCCTGAACGGCCCCACCCCCACCCCCA |
| Internal bar code: | GAGGGTAGCTTTTCTGTTTACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 656 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTGCTCGAAGTACCACACG |
| Suggested primer 2: | TGCAATTTCAACAGTGCGGG |