| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.012788 |
| Chromosome: | chromosome 6 |
| Location: | 2098468 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g266000 | STK1 | Serine/threonine protein kinase; (1 of 15) PTHR12291:SF23 - PROTEIN MEC-15 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCATCTTCCCCACGCAGCCGCACGAGTTATCATATATGCTCTACTTTGA |
| Internal bar code: | TTCTCGGATTTCTATTCTGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1426 |
| LEAP-Seq percent confirming: | 40.625 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCTCAGGCTGCAATCTGGG |
| Suggested primer 2: | CTGCCAAACATGCAAGTGCT |