Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.013024 |
Chromosome: | chromosome 17 |
Location: | 1239359 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g705050 | LIC1 | (1 of 3) PF02931//PF02932 - Neurotransmitter-gated ion-channel ligand binding domain (Neur_chan_LBD) // Neurotransmitter-gated ion-channel transmembrane region (Neur_chan_memb); Ligand-gated ion-channel | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGGCGCCGCCGGCAAAGGCGGCGCCAGCCGCCACCGTGGCTGCTGCGG |
Internal bar code: | TAGATGCGCGTGCGGCCAAGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1154 |
LEAP-Seq percent confirming: | 41.6667 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTGAGAGCGTGTGGACACT |
Suggested primer 2: | CGTGCGACTCTACGAGTACC |