| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.013187 |
| Chromosome: | chromosome 13 |
| Location: | 4011068 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g590500 | FAD6,DES6 | (1 of 1) K10255 - omega-6 fatty acid desaturase (delta-12 desaturase) (FAD6, desA); Omega-6-fatty acid desaturase, chloroplast isoform | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCCGACCGTGTGACGGCTCCGCGGCTGTGAAGAATTTCATCCGCATTG |
| Internal bar code: | GTCTGTCGAAGTGCATTTGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2966 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 77 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 77 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTGCACGAGTTTCAAGTT |
| Suggested primer 2: | TCCCTACCGTCTGCAGTACA |