| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.013196 |
| Chromosome: | chromosome 1 |
| Location: | 4065693 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g026900 | SSA14 | Kynurenine 3-monooxygenase; (1 of 5) 1.14.13.9 - Kynurenine 3-monooxygenase / Kynurenine 3-hydroxylase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCAGCTGCTGGCGCACGTCATCCTGGGGACCATCCTGTCCAAGGTGCG |
| Internal bar code: | GACGGTGGGACTTAAGGTCGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 268 |
| LEAP-Seq percent confirming: | 81.8182 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCCCAAAAACCTCTGCAC |
| Suggested primer 2: | CGACTTCTATCCTCGGTCGC |