Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.013349 |
Chromosome: | chromosome 2 |
Location: | 1263124 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g082000 | AGE1 | DNA repair glycosylase; (1 of 1) K03575 - A/G-specific adenine glycosylase (mutY) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGCACCGCTGCGCACCACCCGCGCCCCAAGTCAGGCTGGTCGCACGGG |
Internal bar code: | TGTCTGCATGTTTATTTGCAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3455 |
LEAP-Seq percent confirming: | 89.1304 |
LEAP-Seq n confirming: | 41 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACATGACACACGACAGTCCC |
Suggested primer 2: | GAGGAAGGCACTGGGAAGAC |