| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.013386 |
| Chromosome: | chromosome 5 |
| Location: | 980320 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g247050 | CTR4,COPT1 | CTR type copper ion transporter; (1 of 2) K14686 - solute carrier family 31 (copper transporter), member 1 (SLC31A1, CTR1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGACCATGCCGCGCACAGCCACGGCGCTAGCAACACGCCCGCTCCATCC |
| Internal bar code: | GCCAGCAACACCGTAGTACGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 976 |
| LEAP-Seq percent confirming: | 84.375 |
| LEAP-Seq n confirming: | 27 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTCGCCACTCACTTCTGTC |
| Suggested primer 2: | CAAGAAGTTCGCAAGTGCCC |