| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.013403 |
| Chromosome: | chromosome 12 |
| Location: | 9082021 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g544400 | STK | (1 of 1) K08838 - serine/threonine-protein kinase 24/25/MST4 [EC:2.7.11.1] (STK24_25_MST4); Serine/threonine protein kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGACGCGCACTGGTGGCAGGTGCGGGTATGGGGTGATGCCGGTGATGC |
| Internal bar code: | AGGGGTTCCGACTTTGGGTGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1937 |
| LEAP-Seq percent confirming: | 94.3396 |
| LEAP-Seq n confirming: | 50 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAAACCGCAACACAATCCT |
| Suggested primer 2: | CTTTTGCCTTCCGCTTTGCT |