| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.013412 |
| Chromosome: | chromosome 16 |
| Location: | 2134922 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g657950 | SSA5 | cilia-sensing, structure and/or assembly; (1 of 1) K06259 - CD36 antigen (CD36) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTGCGCTGCACACCCCCTTGCTTTTCTCCCTCCTCCGGGAATGCTGAT |
| Internal bar code: | AGGCAGATAAGGCATGGAACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 956 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 20 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGCTTATCGCGGGTAAGT |
| Suggested primer 2: | CAACACAACACCACTGCGAG |