Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.013446 |
Chromosome: | chromosome 6 |
Location: | 4726727 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g279300 | (1 of 1) 2.7.10.1//2.7.10.2//2.7.11.1 - Receptor protein-tyrosine kinase / Receptor protein tyrosine kinase // Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase // Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCCGCAACCGTGGGCCGCAACTGCGCCATATACATGCGCGGCGCAGTA |
Internal bar code: | TGCGTCGTAACAAACTGCTAAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3177 |
LEAP-Seq percent confirming: | 99.2958 |
LEAP-Seq n confirming: | 141 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 142 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGGTTGCGCTGATAGCATG |
Suggested primer 2: | GCGGCGTGGTAATCGTTTAC |