| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.013449 |
| Chromosome: | chromosome 16 |
| Location: | 3714339 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g681301 | MOT12 | Predicted protein; (1 of 7) IPR000048//IPR027417 - IQ motif, EF-hand binding site // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTAATGCGTGGCAAGGCCATCCACGGACCCTCCCTCACCCACAGCCCT |
| Internal bar code: | CAGGTTCACGACAGACCTTCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1795 |
| LEAP-Seq percent confirming: | 95.4545 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTATTTACCGCGCTGTGCAC |
| Suggested primer 2: | CGCGCGGATTGATCACTTTT |