| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.013584 |
| Chromosome: | chromosome 13 |
| Location: | 1370366 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g571700 | CDPK9 | (1 of 1) PF00069//PF07714//PF13499 - Protein kinase domain (Pkinase) // Protein tyrosine kinase (Pkinase_Tyr) // EF-hand domain pair (EF-hand_7); Calcium/calmodulin-dependent protein kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTCTCGCTGCTTGCCCGGGTCCTCCTGGTTCTTTTGCACCGTCTTGAC |
| Internal bar code: | CCTTACTCCTCAATAGGGATAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3028 |
| LEAP-Seq percent confirming: | 97.1429 |
| LEAP-Seq n confirming: | 34 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCTCCACGAAGCCAGTTCA |
| Suggested primer 2: | TACGCTCAACTTTCCACGCT |