| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.013603 |
| Chromosome: | chromosome 1 |
| Location: | 907952 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g005150 | SGA1 | Serine glyoxylate aminotransferase; (1 of 1) 2.6.1.44//2.6.1.45//2.6.1.51 - Alanine--glyoxylate transaminase / Alanine--glyoxylate aminotransferase // Serine--glyoxylate transaminase / SGAT // Serine--pyruvate transaminase / Serine--pyruvate aminotransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCCTTGTAGAACTCCGCAAACCAGGGGTCGCGGTGGTTCTGGCCGGGC |
| Internal bar code: | TAGATCACTAGACCATTTTATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3055 |
| LEAP-Seq percent confirming: | 96.9231 |
| LEAP-Seq n confirming: | 63 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTTCGACACTGTCAGCAT |
| Suggested primer 2: | AGGGAACGTGGGTATGCAAG |