| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.013607 |
| Chromosome: | chromosome 13 |
| Location: | 1572867 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g573100 | MAM3C | (1 of 5) K16302 - metal transporter CNNM (CNNM); Protein putatively involved in mitochondrial biogenesis | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCAAAACACACACGCACGCCACAACCCCATCCTTTACGCACCTGGAAC |
| Internal bar code: | GTTGTCTTAAGAGTTCCGGCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2593 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 81 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 81 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGACCTAATTGCCATGCAGC |
| Suggested primer 2: | AACAGGGTGTGGTGGCTATG |