| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.013613 |
| Chromosome: | chromosome 15 |
| Location: | 5338245 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g734400 | CUL2,CUL3 | (1 of 1) K03347 - cullin 1 (CUL1, CDC53); Ubiquitin ligase SCF complex subunit Cullin | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCATGCCGTTTGAGCACGCGCCTTGCGCAGCCTCTTACCTGCTATGCCT |
| Internal bar code: | TAACCAGTTAGTGAGATGGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1321 |
| LEAP-Seq percent confirming: | 88.0597 |
| LEAP-Seq n confirming: | 59 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATCAAGCTACCGCATGTG |
| Suggested primer 2: | CCTATCGAGCTGGCAGAAGG |