Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.013679 |
Chromosome: | chromosome 14 |
Location: | 1559863 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g618150 | (1 of 1) PF07058 - Microtubule-associated protein 70 (MAP70) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGTAGAGCTCCCTGTGCACAGGGCTAACACAACCTGGGCCCACCATTC |
Internal bar code: | ATGTGATGTGGTTTACTAACGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4730 |
LEAP-Seq percent confirming: | 90.2857 |
LEAP-Seq n confirming: | 158 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 175 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATGCGCATCTTGAAGGAGC |
Suggested primer 2: | TTCTCGCCGTCCATCTTAGC |