Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.013751 |
Chromosome: | chromosome 15 |
Location: | 5605958 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre26.g756897 | (1 of 1) IPR000104//IPR003903 - Antifreeze protein, type I // Ubiquitin interacting motif | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAAAGCGGCGAATGGTTAGGGTCCCGGAAGAAAGACTCGTCCGCAGCAG |
Internal bar code: | CTCAACTGTATAGATGTGTTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4354 |
LEAP-Seq percent confirming: | 98.1132 |
LEAP-Seq n confirming: | 52 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCAATTCTGCACGTTTGGC |
Suggested primer 2: | TTTCAGTAGCTGTGCCCAGG |