| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.013753 |
| Chromosome: | chromosome 3 |
| Location: | 4624723 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g176866 | NAP1,NAP | conserved protein of unknown function | CDS |
| Cre03.g176900 | (1 of 2) 2.1.1.282//2.5.1.114 - tRNA(Phe) 7-((3-amino-3-carboxypropyl)-4-demethylwyosine(37)-N(4))- methyltransferase / tRNA-yW synthesizing enzyme-3 // tRNA(Phe) (4-demethylwyosine(37)-C(7)) aminocarboxypropyltransferase / tRNA-yW synthesizing enzyme-2 | 5'UTR | |
| lncRNA_TCONS_00065698 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATGTGAGGTGGGGAACATCAGGTTGGGTTGGAGCTGGGTGAACGGAGG |
| Internal bar code: | GTGAGTTAAAACTATGTCAGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 72 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGTCTAGGTGGTTGTGGG |
| Suggested primer 2: | CGTCCGAACACGTCAGTACA |