| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.013805 |
| Chromosome: | chromosome 3 |
| Location: | 1305632 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g150251 | (1 of 80) IPR003882 - Pistil-specific extensin-like protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCATCGCCAGACGGCCTAGGCACTGCGGACGCGCCGCCGCCGCCGCCG |
| Internal bar code: | AGGCGGTGCAAGTGCGGGTTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 743 |
| LEAP-Seq percent confirming: | 89.4737 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATCTCAGGGGATGGTGGGA |
| Suggested primer 2: | AAACACGAGTCGGTGGGTAC |