| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.013882 |
| Chromosome: | chromosome 16 |
| Location: | 4755667 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g687950 | ETFA1,ETF1,ETFA | Electron transfer flavoprotein alpha subunit; (1 of 1) 1.3.1.95 - Acryloyl-CoA reductase (NADH) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCTACCAGGCCAGCTAGAGGCGCTAGTGTGTGGCTCTGGCGATGCCGT |
| Internal bar code: | GGGTCGACGACACAACGGCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 6208 |
| LEAP-Seq percent confirming: | 98.3871 |
| LEAP-Seq n confirming: | 61 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGAAAGCACCATCCTCGT |
| Suggested primer 2: | CCGCTAGCATTGTCGCTTTC |