| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.013895 |
| Chromosome: | chromosome 15 |
| Location: | 733971 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g801691 | (1 of 18) PTHR10774 - EXTENDED SYNAPTOTAGMIN-RELATED | intron | |
| lncRNA_TCONS_00216392 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCAAACTGCAACGCGACACCCGCCATCTAGACACGATCATTGCGGGGAC |
| Internal bar code: | GTATGGTGCATTACGTGCACGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 356 |
| LEAP-Seq percent confirming: | 81.8182 |
| LEAP-Seq n confirming: | 27 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCCCCTTCCTTCCCCATA |
| Suggested primer 2: | CACCCATCGTATCGGTCTGG |