| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.013909 |
| Chromosome: | chromosome 5 |
| Location: | 634993 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g245100 | (1 of 41) PTHR10157 - DOPAMINE BETA HYDROXYLASE RELATED | intron | |
| Cre05.g245150 | (1 of 30) PF13450 - NAD(P)-binding Rossmann-like domain (NAD_binding_8) | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGACCCTCCCGTCTGAGCGCAAACCCTAGACACGGGCTGACCCTGTCGAC |
| Internal bar code: | TGGCGAATTGGCTTTCCGGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 960 |
| LEAP-Seq percent confirming: | 95.4545 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGGGGGCGTGATTTGTATT |
| Suggested primer 2: | CAGCTGTTGACTGAGCAGGA |