Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.013952 |
Chromosome: | chromosome 10 |
Location: | 1161310 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g425700 | NUP107 | (1 of 1) K14301 - nuclear pore complex protein Nup107 (NUP107, NUP84); Nucleoporin 107 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGCGGCCTATGCGCCCAGATTCCCAGTCCTGCAACATACGCAAACGCA |
Internal bar code: | TTACTCGTTCGAAGTCCAAGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 124 |
LEAP-Seq percent confirming: | 66.6667 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTGGAGTCCCAGCTCAGTC |
Suggested primer 2: | CAACGACTCGCTTATGCAGC |