Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.013988 |
Chromosome: | chromosome 1 |
Location: | 2242682 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g012500 | PRA1 | (1 of 2) PF03208 - PRA1 family protein (PRA1); Similar to Prenylated Rab Acceptor Protein | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATCGTCATGTTGCTCTGCACGGCGTTCACGTTTGTGCTGCACCCTTCGT |
Internal bar code: | TACTAAATTACCACTAAGAGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2261 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 16 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAGAAAACGGTGCCCACAC |
Suggested primer 2: | CAGCTTACATAGGCGCGGTA |