Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.014359 |
Chromosome: | chromosome 10 |
Location: | 2309067 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g434350 | CTR2 | CTR type copper ion transporter; (1 of 2) PTHR12483//PTHR12483:SF27 - SOLUTE CARRIER FAMILY 31 COPPER TRANSPORTERS // COPPER TRANSPORTER 1A, ISOFORM C-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCCTTGATTCTTTGTTTAACACACACACCTGCCCCCAGTCCCACGCC |
Internal bar code: | CGGACATTACAAGGTAATTGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2315 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 27 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTGAGCTACGTCTACCCGA |
Suggested primer 2: | GTTCAGGCCAGCTGTGTTTG |