| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.014486 |
| Chromosome: | chromosome 6 |
| Location: | 5481659 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g286250 | MPC1,MSCP1 | (1 of 4) K15111 - solute carrier family 25 (mitochondrial S-adenosylmethionine transporter), member 26 (SLC25A26); Mitochondrial substrate carrier protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGACTGACGTGACGCAGGCCATTGCAGTCAACCTTCTTATGCTCCCCGCC |
| Internal bar code: | TGATAGACCGTTGCTGGTCTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3765 |
| LEAP-Seq percent confirming: | 98.2456 |
| LEAP-Seq n confirming: | 56 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGGGTGCATGACGACTAA |
| Suggested primer 2: | TTCACTACGCCCAGGGAAAC |