| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.014583 |
| Chromosome: | chromosome 6 |
| Location: | 2384451 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g268450 | (1 of 1) PTHR22850//PTHR22850:SF85 - WD40 REPEAT FAMILY // WD-40 REPEAT-CONTAINING PROTEIN MSI4-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCGCAATCAATCGCAATCCCGTTCCCCCGACGCGCCTGCTATGCCGCT |
| Internal bar code: | TGATTCATCGCCGTGAGCTTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 164 |
| LEAP-Seq percent confirming: | 68.1818 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCCACCCCTCCTTCTCCTC |
| Suggested primer 2: | TCCTGCCTCATCCCATACCA |