| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.014709 |
| Chromosome: | chromosome 17 |
| Location: | 2254744 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g713100 | (1 of 78) IPR002110//IPR020683 - Ankyrin repeat // Ankyrin repeat-containing domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTCGCGTGCCGCTTCAGGCAGTCCAATCAGCCCTGGTGGGTTTGGTGC |
| Internal bar code: | GATGGTAGTTATGTCAGAACAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 543 |
| LEAP-Seq percent confirming: | 77.7778 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGATGGCTACTCCCCCTT |
| Suggested primer 2: | ACACTCCAAGAGAAGCCGTG |