Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.014729 |
Chromosome: | chromosome 3 |
Location: | 3213059 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g165215 | ATG7 | (1 of 1) 2.7.7.49//2.7.7.7//2.7.7.80//3.1.26.4 - RNA-directed DNA polymerase / Revertase // DNA-directed DNA polymerase / DNA-dependent DNA polymerase // Molybdopterin-synthase adenylyltransferase // Ribonuclease H / RNase H; E1 activating enzyme for ATG8 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAAGTATTTTCGCTCGCAACTAACACCTCTGCCTGCACTCCCGTTTTCG |
Internal bar code: | TGTTTCTAGTATTTATTCCCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 383 |
LEAP-Seq percent confirming: | 83.3333 |
LEAP-Seq n confirming: | 15 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGAGTAGGGGAGAAGGGGAG |
Suggested primer 2: | CTTTTCCCTTCCCCTGTCCC |