Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.014760 |
Chromosome: | chromosome 10 |
Location: | 5719934 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g459550 | B9D2B | (1 of 1) PTHR12968:SF2 - B9 DOMAIN-CONTAINING PROTEIN 2; B9 Domain-Containing transition zone protein 2 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGTTGGGGATAGATGGACGTGCGGCTGAGGCCAGGACAGTGCGGTGTG |
Internal bar code: | TGTCTCCATCTGTGGCTTGAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 723 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 35 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTCTCTCTCTCCCTTCCCC |
Suggested primer 2: | CCTCGCTAACATGCACATGC |