Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.014895 |
Chromosome: | chromosome 6 |
Location: | 2337954 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g267700 | SPPA1-2,SPP1B,SPP2 | Signal peptide peptidase; (1 of 1) PF00574//PF01343 - Clp protease (CLP_protease) // Peptidase family S49 (Peptidase_S49) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCTCAGCCTCCTGCTGCGGGGCCGGCTGCAGGTGGGTGGGTGGGAGGA |
Internal bar code: | TTCCTGGAAGGAAATCATGCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 606 |
LEAP-Seq percent confirming: | 91.6667 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTAGTTGTTCGTCACGCCCT |
Suggested primer 2: | GGGGTGACAAGCGAGAGAAA |