| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.014962 |
| Chromosome: | chromosome 4 |
| Location: | 229117 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217350 | KUP4 | (1 of 5) K03549 - KUP system potassium uptake protein (kup); Potassium ion uptake transporter | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACACACACACATACACACACACCACAAAAGAACCCTCGCCATCCACCGC |
| Internal bar code: | CAGAGACATTTTTTATTCTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3009 |
| LEAP-Seq percent confirming: | 98.4375 |
| LEAP-Seq n confirming: | 63 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 64 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCACGTCAGACACCACGAA |
| Suggested primer 2: | GTGAGTGGTGGACATGGAGG |