Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.014971 |
Chromosome: | chromosome 12 |
Location: | 8553370 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g549000 | PHC4 | Pherophorin-chlamydomonas homolog 4; (1 of 71) PF12499 - Pherophorin (DUF3707) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGATCGTGACTTGAAGATACAACCAAGCGTTATCTCACTGACGTCTGA |
Internal bar code: | GTAACGGTCTGTGTGACAGGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3227 |
LEAP-Seq percent confirming: | 95.1219 |
LEAP-Seq n confirming: | 39 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGGCAACAAAAGCGTCAGG |
Suggested primer 2: | CATGCACGCGAACTATGTGG |