Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.015055 |
Chromosome: | chromosome 3 |
Location: | 6056568 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g800353 | (1 of 1) K06631 - polo-like kinase 1 (PLK1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTGAACATTTTTGCGAAGCAACCTGAAGCAGTAGGGTACTTGCCGGGA |
Internal bar code: | AGGTACAGGTAGACATAGCTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2223 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 50 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCAGGTCTCCCACTTTGAC |
Suggested primer 2: | TATGGGCCTTGCTGTTCAGG |