| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.015149 |
| Chromosome: | chromosome 2 |
| Location: | 5783985 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g116950 | HDA1 | RPD3/HDA1 type histone deacetylase; (1 of 2) 3.5.1.4 - Amidase / Acylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAACATACCTGACAAACACGCACGCAGCTGGATGATGGCACAGCTGAAGG |
| Internal bar code: | TGATGGAACAGTCTTAATATGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3272 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 57 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCACACCACTCCACCTCC |
| Suggested primer 2: | CGTAGCTACGTGACGGAGAC |