Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.015281 |
Chromosome: | chromosome 3 |
Location: | 6404867 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g800361 | (1 of 1) IPR001584//IPR001878//IPR001986//IPR012337//IPR013103//IPR025724 - Integrase, catalytic core // Zinc finger, CCHC-type // Enolpyruvate transferase domain // Ribonuclease H-like domain // Reverse transcriptase, RNA-dependent DNA polymerase // GAG-pre-integrase domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGCCACCCCTGGCACCCGAACCCCCGCCGCCGCCCTTGCCGCGCTTCT |
Internal bar code: | GTGCTGTTTTCTTATACTATGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3311 |
LEAP-Seq percent confirming: | 75.0 |
LEAP-Seq n confirming: | 12 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTATACCTCGACGCCACCTG |
Suggested primer 2: | CCCACAGCACATGACTCACT |