Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.015293 |
Chromosome: | chromosome 5 |
Location: | 3011615 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g230900 | DPP1,PAP1 | (1 of 3) PTHR10165:SF35 - DIACYLGLYCEROL PYROPHOSPHATE PHOSPHATASE 1-RELATED; Diacylglycerol pyrophosphate phosphatase 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACACAAACCAACCCACAACCTACCTCTCAGCCCACGCCCCACAACTCGC |
Internal bar code: | CAGGATACAAATTTGGACTTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3776 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 60 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 60 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCTCCTCCCATCCTCTGAA |
Suggested primer 2: | CAGAAGGTCAGGAAGCCCAG |