Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.015324 |
Chromosome: | chromosome 7 |
Location: | 3643113 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g337300 | DSK2,DYRK2,DYRKP1,DYRKP,STD1 | Dual-Specificity Tyrosine-Regulated Protein Kinase involved in starch degradation; (1 of 2) PTHR24058//PTHR24058:SF23 - DUAL SPECIFICITY PROTEIN KINASE // SERINE/THREONINE KINASE-RELATED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGAGGAGACCAAGGACTTCCCCATCCGCCTCAACGACCTCATAGCGGGC |
Internal bar code: | ATACTTCGGGTGGAATTTGGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3067 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GATCTTGAGGCACACCAGCT |
Suggested primer 2: | AAGGGTGAGCGAGTGTCATG |