Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.015407 |
Chromosome: | chromosome 17 |
Location: | 2291529 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g713400 | HTA31,HTA22,HTA25 | Histone H2A; (1 of 30) K11251 - histone H2A (H2A) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTTACCGCTGAGGTGCTGGAGCTGGCCGGCAACGCCGCTCGCGACAAC |
Internal bar code: | GGGCAATTCGGGTAGGCTTGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4111 |
LEAP-Seq percent confirming: | 99.0741 |
LEAP-Seq n confirming: | 107 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 108 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTCTGGGAAGGACCGAAGC |
Suggested primer 2: | GAGCGGTTGTTTGACCCAAC |