| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.015498 |
| Chromosome: | chromosome 16 |
| Location: | 2597269 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g661050 | RPL34 | (1 of 1) K02915 - large subunit ribosomal protein L34e (RP-L34e, RPL34); Cytosolic 80S ribosomal protein L34 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCAGCGCTACCCAAGGCGCTACCAGCTCTCGTGCGTCCTGCCGGCCCA |
| Internal bar code: | CAAATATAATTGCATATCATCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5375 |
| LEAP-Seq percent confirming: | 99.3197 |
| LEAP-Seq n confirming: | 146 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 147 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGTCCCATGTTCCTTTCCG |
| Suggested primer 2: | GGTCGCTCAGTGTGAAGTCA |