| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.015557 |
| Chromosome: | chromosome 6 |
| Location: | 3781573 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278170 | FAP237,FAS7,FAS16,FLA11 | Flagellar Associated Protein 237; (1 of 1) PTHR10900:SF77 - PROTEIN F26E4.7, ISOFORM A | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGTCATGCTAGGAGCGGCCTACCCCGTCCCTGCTTTTGGGCTTTTCGGA |
| Internal bar code: | TTAGAGGTTGAAACGTCCCATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1873 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGATGACCTTGGCGGAGT |
| Suggested primer 2: | GTGTTGGGTACTGGAGAGGC |