Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.015583 |
Chromosome: | chromosome 10 |
Location: | 5693427 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g459350 | OPR49,RAP5 | OctotricoPeptide Repeat protein 49; (1 of 2) IPR000104//IPR013584 - Antifreeze protein, type I // RAP domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATACGGTATTGGCATGAGTCGCATGACATAGCAACATAATTAGGAGGTC |
Internal bar code: | TGATGCACGATATTTAAGGTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1347 |
LEAP-Seq percent confirming: | 97.2222 |
LEAP-Seq n confirming: | 35 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGTAGACGGGAGAGGGGAT |
Suggested primer 2: | AACGCAGACGACACAAAACG |