| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.015604 |
| Chromosome: | chromosome 15 |
| Location: | 1255892 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g801725 | NCL64 | Nuclear Control of chloroplast-Like 64; (1 of 39) PF08373 - RAP domain (RAP) | 5'UTR/CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTACAGTTCGCACGCGCCAGCGCCACAGCGAGTAGACATGGCTTAGGC |
| Internal bar code: | CACGTATGCGTAGAGAAGATCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 151 |
| LEAP-Seq percent confirming: | 5.45455 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 52 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCCTAGCCTAACCTCTCA |
| Suggested primer 2: | GCTCCCCTGTTAATGCTGGT |