Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.015625 |
Chromosome: | chromosome 10 |
Location: | 5714528 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g459500 | NGB1 | Nucleolar GTP-binding protein; (1 of 1) PTHR11702:SF4 - NUCLEOLAR GTP-BINDING PROTEIN 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGGGGGGGGGCTGTAGTGGCGGAGGTTACGGGGCTCAGTAGCATCCAT |
Internal bar code: | CGTGGGGGGAGTTTTGTTACGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2247 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 15 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCGAGGCACACAGTAACACC |
Suggested primer 2: | AGCAAGTCACGGTGAGGAAG |