| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.015784 |
| Chromosome: | chromosome 1 |
| Location: | 4588534 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g031650 | CGLD12 | Conserved in the Green Lineage and Diatoms; (1 of 2) PF05637 - galactosyl transferase GMA12/MNN10 family (Glyco_transf_34) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGTCGCCGGACTTGCCGCTGGCTGCGTCGGTGCGGATGAAGCCGGACA |
| Internal bar code: | CATCCTCGCGGCACTCCACAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2337 |
| LEAP-Seq percent confirming: | 94.4444 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTAATGTGGGTGGATGCA |
| Suggested primer 2: | CCCAATCCTGAACAGACCCC |