Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.015822 |
Chromosome: | chromosome 14 |
Location: | 2727671 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g626000 | (1 of 6) PF03547 - Membrane transport protein (Mem_trans) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGTGCGACAATCCTACCGGCATCATCGATGCTGACCCTGACCCACGCA |
Internal bar code: | AGCTCCTGATGGGGCATCGGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 185 |
LEAP-Seq percent confirming: | 81.8182 |
LEAP-Seq n confirming: | 9 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAAGCTCATAGCAGCGCATG |
Suggested primer 2: | ACCCATGTGCGTGTCATTCT |