| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.015856 |
| Chromosome: | chromosome 12 |
| Location: | 3975130 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g515650 | EIF3K | Eukaryotic translation initiation factor 3, subunit K; (1 of 1) K15028 - translation initiation factor 3 subunit K (EIF3K) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAACCAGCTCTATCTGCTGCTCTGCTGCAGTCCCCGGCTTCTACGAGTCG |
| Internal bar code: | ACAAAGCTGTTTTAATTTTTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1768 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGATGCTAGCTGATGAGGCG |
| Suggested primer 2: | CAGGGTGAGCATCCACTTGT |