Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.015932 |
Chromosome: | chromosome 3 |
Location: | 7804730 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g203100 | (1 of 1) IPR000253//IPR027417 - Forkhead-associated (FHA) domain // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGTGCGCAGCCAAGCAGGTTGCGGCCGGACCAATAGAATGCCCATAAG |
Internal bar code: | AACGTTTGTGGCAGGGCTCATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3123 |
LEAP-Seq percent confirming: | 98.7342 |
LEAP-Seq n confirming: | 78 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 79 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTGACGTGACTTCTGGTGA |
Suggested primer 2: | GCACAGCCGTCCAAGTTTG |