Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.016042 |
Chromosome: | chromosome 7 |
Location: | 5343659 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g350100 | (1 of 1) IPR000104//IPR006311//IPR017956//IPR026741//IPR026937//IPR027417 - Antifreeze protein, type I // Twin-arginine translocation pathway, signal sequence // AT hook, DNA-binding motif // Protein strawberry notch // Strawberry notch, helicase C domain // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACAATCGCTACAAGTACCACAAATAAGCATACGCAAGTGCTCAGGGCAT |
Internal bar code: | AGAAAAACAAAGAAATGTCATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 636 |
LEAP-Seq percent confirming: | 90.9091 |
LEAP-Seq n confirming: | 10 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTGCTGTCACATTTGGGGC |
Suggested primer 2: | GATGAAGGACTGGGTGTGGG |